Dorky Disboutiquing DiserSistas:Destination DisneyTeresajoys(true)version:TheEnd 1/23

Loving this report girlie! We need more .... MORE!
 
Great trippie so far. I'm laughing at the rental car story. :lmao: :lmao:
 
Thieves! :rotfl2:
Hurry your sister up so we can read more!


I think maybe it should be a CONTEST :idea: Who can post more or faster, Heather or Teresa :rolleyes1

And BTW Teresa, you MADE me go out and buy 2 of those cameras. My big kids have been wanting cameras forever. When DH gets the AMEX bill I'll come crying to you. That sears shipping was EXPENSIVE!
 
That is so funny about the Palm Tree comment. That is exactly what Jenna said as we were driving. This was the conversation:
Jenna: "We are in Florida now right?"
Me: "Yes we are now in Florida. Why do you ask?"
Jenna: "I just saw a palm tree so I knew we were in Florida."
Me: :lmao:
 

I think maybe it should be a CONTEST :idea: Who can post more or faster, Heather or Teresa :rolleyes1

And BTW Teresa, you MADE me go out and buy 2 of those cameras. My big kids have been wanting cameras forever. When DH gets the AMEX bill I'll come crying to you. That sears shipping was EXPENSIVE!

Allright!!! When he sees it, you come and fly to Michigan!!! I love that plan!!! Bring the kids!!!!
That is so funny about the Palm Tree comment. That is exactly what Jenna said as we were driving. This was the conversation:
Jenna: "We are in Florida now right?"
Me: "Yes we are now in Florida. Why do you ask?"
Jenna: "I just saw a palm tree so I knew we were in Florida."
Me: :lmao:

That IS funny!!!! Kids, they are so cute!!! Have you started your TR yet? I cant' wait to read it!!!
 
waiting patiently for more....and running out of popcorn popcorn::

Please, some more :hug:
 
Joining in! Great TR so far. Love your style. Your family seems like lots of fun!!
Guess I will have to get one of those cameras for DS too. Maybe you should get commission (sp?) for advertising this camera -- you just might be able to fund your next Disney trip!!! :goodvibes
 
Ok i read your sister's TR and I just finished yours. I'm a lurker from the boutique thread, currently learning to sew because of that thread. I think this is so cool that both of you are doing a report because then I get twice the amount of Disney TR's. That camera is cool. Hmmmm - I have a Sears gift card for $50 in my cabinet.
 
I thought maybe I'd be forgotten again. :sad1: (Although I do believe that was HEATHER that left my name out of the "Disers we met at Disney".)
I would never forget you!!!

:surfweb: waiting for more!!

Ok, ok, it's coming, it's coming!!!



waiting patiently for more....and running out of popcorn popcorn::

Please, some more :hug:

Oh goodness, that's awful, let me hurry up and post an update!! We don't want a popcorn emergency around here!

Joining in! Great TR so far. Love your style. Your family seems like lots of fun!!
Guess I will have to get one of those cameras for DS too. Maybe you should get commission (sp?) for advertising this camera -- you just might be able to fund your next Disney trip!!! :goodvibes

More, more, more!!!

Thanks!!! We are a lot of fun, if I do say so myself!!!

It is a very cool camera!

Ok i read your sister's TR and I just finished yours. I'm a lurker from the boutique thread, currently learning to sew because of that thread. I think this is so cool that both of you are doing a report because then I get twice the amount of Disney TR's. That camera is cool. Hmmmm - I have a Sears gift card for $50 in my cabinet.

Ok, since Heathe posted her update, I can now post mine! Give me a minute to add some pictuers and we'll be on our way!
 
Once we got on the toll road, we could no longer hold hands, because I was CONSTANTLY digging through my purse every 1/4 mile for MORE and MORE and MORE money for the tolls! Why don't they just charge you one toll when you get off the toll road like Indiana does????

Only later did we find out that my parents, my FATHER the retired Fisher Body worker had done the EXACT same thing with the rental car!!! We are quite sure that they were pulled to the EXACT same car we had been and loaded in the luggage as well! Stranger still, we both then picked the exact same color of Chevy Uplander! We had to buy a new antenna topper for ours just to tell them apart!


While driving to the house, Brian asked what I'd like to do. I told him that I'd really like to check out the outlet mall. He said that was good, because he wanted to go to the Bass Pro Shop. We do this every year, he drops me off a the mall, and he goes across the street to the Bass Pro Shop. It was a good plan, a tradition so to speak or so I thought...


Once we pulled up to our house, I was relieved to see that it no longer had a For Sale sign in the front yard, and more relieved to find out that the key code worked!!! Uh huh yee hah!!! :woohoo:

It was a nice house, but I noticed that it was pretty warm. I didn't think much of it, and we started carrying in our luggage. The girls had a room with two sets of bunkbeds, and Corey had a room to himself with two twin beds.

Brian put our stuff into a room with a bathroom attached, that was across the living room from the girls. He figured we (meaning me) could get to the girls' room quickest from the bedroom he had picked. I know what you are thinking, four little girls in ONE room?? Were we crazy?? No, not crazy, but we are cheap! This was the only way we could fit all 11 of us into a 5 bedroom house!


There was a swimming pool off the living room. (which is kind of scary!):scared1: There was an alarm on the door, that we couldn't quite figure out how to turn off at first. That was fun, NOT! I looked through the very vague welcome book that was left for us, but saw absolutely no directions for turning off the alarm. Through trial and error, we figured out that you had to push it just before going out, and shut the door quickly and then when you came in, push it right away. Otherwise, you were rewarded with ear splitting beeping! It was a nice safety feature, but directions would have been nice! There was also a fence between the house door and the pool. Even so, I sat the kids down and threatened them to NOT even LOOK at that door without a grown up right next to them. I made sure Corey knew that he was NOT considered a grown up in my book. They know how serious I am about pool safety, so they listened very well. :listen:


Apparently, while the kids and I were swimming, an air conditioning repairman came to our door to fix the a/c. Which was good, because the house was getting hot and stuffy. When Brian told me the repairman was there, I got confused, because I had not called anyone, and the owner was in England. Apparently the management team had been out and realized the A/C wasn't working.

After a brief swim, I ask Brian if he just wants to stay at the house and go to Walmart to get something to cook up for supper. He says he really wants to go to the Bass Pro Shop, so we load into the car and head off to International Drive..... on a Saturday..... yeah, good plan.

While we were leaving, the A/C guy told us that he would have the A/C fixed before we got home and the house would be cool when we got home. Strangely, as we were turning onto 192 from 27, the A/C guy passed us. This was only a few minutes down the road from the house we were staying at!


I-drive wasn't too bad, and we made it to the Bass Pro Shop fairly quickly. However, instead of taking me to the mall, Brian starts to park at Bass Pro Shop. I tell him that it's ok, I'll just drive over to the mall. At this point, he gets very upset with me, and asks what I'm talking about. I remind him of our earlier conversation about me going to the outlet mall. He seriously has no clue what I'm talking about, or at least pretends not to. So, he storms off, into the store. I wait briefly to see if he is coming back, then slide into the driver's seat and go across the street to the outlet mall, which really is just the Disney outlet store to me, because I don't care about any of those other stores in there!

I was pretty excited, because I knew that they had "remodeled" the mall since we were there last year. Well, remodel is not the right word! They must have bull dozed the entire thing down, because what was once an enclosed mall was now a nice bright airy open mall.

Arminda took some pictures:
213a506f.jpg


The kids and I quickly located the Disney store and started in for some serious shopping or at least some serious looking!
5f798168.jpg


I was still pretty upset about the whole argument with Brian, but I knew we would both get over it quick enough.

I didn't find many good deals this day, but Corey did pick out a pair of red Mickey Crocs! Which, I could tell he really wanted, but was a bit hesitant to buy! So, me and a CM talked him into them, and he was very happy! While shopping, a CM took a picture of us trying on some cowboy hats, she was very friendly:

edc6e873.jpg

Yeah the dork gene runs strong in our family!

Arminda and Lydia got very excited when they found these:
616afbb9.jpg


My Mom had given everyone Disney gift certificates or Disney dollars for her anniversary (Yepers, my parents give US presents on their anniversary!) so, the girls bought themselves a lollipop.

I was anxious to get back across the street to get Brian and to get home to greet my parents, so I told the kids we had to get going. After I paid for the shoes, Arminda told me that while I was paying, a CM had asked her if she wanted to play a game. Arminda was a good girl and told her no, that we had to leave. When I found out, I told Arminda we had a few minutes, and she could play the game. The CM got out a book and asked Arminda some questions about different characters. She then dumped out a container filled with pins and told Arminda to pick one. She then gave Lyddy a little quiz and let her pick out a pin too. Corey was a little disappointed that he didn't get to play too. The girls both picked out rather boring pins, if you ask me or Corey, but they were happy with them. But, there were some REALLY cool ones that they didn't even look at! :faint:


After driving back to Bass Pro Shop, we quickly located Brian in the fishing section (of course!)He told us that after he had went into the store, he felt bad and had come back out to the parking lot so he could come with us, but we were gone already. So, he walked across the street to the mall looking for us. I felt really bad then, I should have waited a little longer. (but really, it WAS his fault.)


He was ready to go, (YEAH!!!) so we headed out. We still hadn't eaten, so we stopped at the Sonic Drive in. I had never eaten at one before, and I thought it was pretty fun!



We then drove to the house, where we saw that my parents and my brother David's family were already there, which was good, since it was 11:00 PM! When I walked in the door, my Mom told me that she didn't think the air was working, which peeved me greatly! Not that she had told me, but that the guy had NOT fixed the A/C! I found the "emergency contact number" and tried to call from the house phone. Unfortunately, the EMERGENCY contact number was long distance from the house, and I needed a calling card to call it!! (Give me a break!) Not having a calling card, I used my Dad's Tracfone. No one answered, so I had to leave a message. :furious:
And, since there is a deplorable lack of pictures in this installment, here is a picture of me calling the emergency contact:


73cd1c12.jpg


Here's Brian after we got back to the house:

2032ce13.jpg



The only room that was unbearably hot was the girl's room, every other room had a fan it but theirs. Plus, there were four giggly excited girls sharing ONE room! They were SOOO excited and SOOO worked up that they did not fall asleep until around 1 AM. Barbara is deaf, so she did not hear them, and David is, well a man, so HE did not hear them!

I was nice, and explained to them that if I did not get any sleep, I would NOT be in a good mood in the morning.

It got quiet for about 30 seconds, then the giggling started again.

I went back in, and explained to them that Grandma was NOT a young little girl, and that she was right on the other side of the wall, and she REALLY needed her sleep if she was going to Disney in the morning. And REALLY did they want to be THAT mean to their GRANDMA???? (I know, I was laying the whole guilt thing on a bit thick)

Quiet for about 4 minutes, then MORE giggling.
I was beginning to think that Brian picked the room he had just so I would get MORE exercise! He of course was sound asleep...:mad:

I went in and I MIGHT have threatened bodily harm......

don't judge me......

Quiet for all of 4 minutes.....
Then, I hear the distinctive giggle of a red headed 5 year old. :hyper:

Enough WAS ENOUGH!!! I had NOT slept in a WEEK! I was EXHAUSTED, AND we were getting up at 6:30!

So, I told Lydia, "Come on, you are sleeping in my room."
I put her on my bed, and she was out within a minute, as were the other girls.

I decided to reset the alarm on the alarm clock to 7:00, I needed SOME sleep after all!

I laid my head down on my pillow, and closed my eyes to slowly drift off into..


GGGAAAAAAAAAAAAAAAAGGGGGGGG
GGGGGGGAAAAAAAUUUUUUUGGGGG
GGGHHHHGUUUUUUAAAAHHHHGGGG!!


UGGH!!!! Brian was SNORING loud enough to wake the dead! I had packed his snore reducing pillow (which really really works for him) BUT, I realized at that point that I had left it at the hotel room in Detroit!!! :faint: I pushed Brian, and told him to roll over onto his side. Sometimes this works long enough for me to fall asleep... but not tonight.

I probably got 3 hours sleep total, and then,
BEEP BEEP BEEP BEEP BEEP

Stupid alarm clock.....:badpc:

But, it was time to get up, we were
GOING TO DISNEY!!!!
but first, I needed a pot of coffee :surfweb: :hyper:

Up Next: Does the Emergency Contact REALLY get annoyed when you call him at 11:30 PM?
Will Teresa sleep walk though Disney????
Will we EVER find Heather......?????
 
Awww, sorry about the spat. I'm very glad you quickly made up. Tom and I usually have one of those every long trip but they don't happen the first day, lol!

Can't wait for more!
 
We went to that same Bass Pro Shop when we left Disney in dear I say 2004. Although I didn't know about the Disney outlet store. The boys were loving it, looking at the big fish tank and we got there just in time for a feeding :cool1: . Anywho love the update, that A/C guy is starting to tick me off, liar liar pants on fire he was. Oh a snooring DH, :faint: and little girls up til after 1 :faint: I would have needed a whole pot of coffee.

Laura
 
Now I'm dying to know if you got the AC fixed. I can't stand being in a hot house!
 
Awww, sorry about the spat. I'm very glad you quickly made up. Tom and I usually have one of those every long trip but they don't happen the first day, lol!

Can't wait for more!

Now, technically, it was sort of the 2nd day of our vacation, since we spent the first night in Detroit. :thumbsup2 So, for us, we were doing pretty good to not fight until the 2nd day! :cool1: :cool1: :cool1:
(I blame it on the fact that he is so old, he can't be expected to remember these things, at his age. :lmao: It's a good thing he doesn't get on here!!!!)
We went to that same Bass Pro Shop when we left Disney in dear I say 2004. Although I didn't know about the Disney outlet store. The boys were loving it, looking at the big fish tank and we got there just in time for a feeding :cool1: . Anywho love the update, that A/C guy is starting to tick me off, liar liar pants on fire he was. Oh a snooring DH, :faint: and little girls up til after 1 :faint: I would have needed a whole pot of coffee.

Laura

Oh my, at the Bass Pro Shop, and you didn't go to the Disney Outlet? :faint:

The kids love it when we go when they are feeding the fish too. That is one cool fish tank, isn't it! Brian could seriously spend the ENTIRE day in that store, (and probably not leave the fishing section). I can spend maybe about an hour, which is why our "normal" plan works out so well. Yep, I'm blaming this whole "misunderstanding" on his age.....
 
Character warehouse looks like fun!
 
I thought maybe I'd be forgotten again. :sad1: (Although I do believe that was HEATHER that left my name out of the "Disers we met at Disney".)

I didn't forget YOU, I just forgot to type in your username. :thumbsup2 Honestly, I typed in LivnDisney and my brain thought I'd already typed yours in. ::yes::

Teresa: Another great update! I love reading your TR because I find out all sorts of things I haven't heard about yet. I love the decription of the "distinctive giggle".

That darn electric blue Dodge- it held us all in it's spell! I am so glad we were strong enough to resist it. Henry must have the strongest Chevy-dar in the family. He didn't even glance at it.
 












Receive up to $1,000 in Onboard Credit and a Gift Basket!
That’s right — when you book your Disney Cruise with Dreams Unlimited Travel, you’ll receive incredible shipboard credits to spend during your vacation!
CLICK HERE


New Posts





DIS Facebook DIS youtube DIS Instagram DIS Pinterest DIS Tiktok DIS Twitter DIS Bluesky

Back
Top Bottom