Once we got on the toll road, we could no longer hold hands, because I was CONSTANTLY digging through my purse every 1/4 mile for MORE and MORE and MORE money for the tolls! Why don't they just charge you one toll when you get off the toll road like Indiana does????
Only later did we find out that my parents, my FATHER the retired Fisher Body worker had done the EXACT same thing with the rental car!!! We are quite sure that they were pulled to the EXACT same car we had been and loaded in the luggage as well! Stranger still, we both then picked the exact same color of Chevy Uplander! We had to buy a new antenna topper for ours just to tell them apart!
While driving to the house, Brian asked what I'd like to do. I told him that I'd really like to check out the outlet mall. He said that was good, because he wanted to go to the Bass Pro Shop. We do this every year, he drops me off a the mall, and he goes across the street to the Bass Pro Shop. It was a good plan, a tradition so to speak or so I thought...
Once we pulled up to our house, I was relieved to see that it no longer had a For Sale sign in the front yard, and more relieved to find out that the key code worked!!! Uh huh yee hah!!!
It was a nice house, but I noticed that it was pretty warm. I didn't think much of it, and we started carrying in our luggage. The girls had a room with two sets of bunkbeds, and Corey had a room to himself with two twin beds.
Brian put our stuff into a room with a bathroom attached, that was across the living room from the girls. He figured we (meaning me) could get to the girls' room quickest from the bedroom he had picked. I know what you are thinking, four little girls in ONE room?? Were we crazy?? No, not crazy, but we are cheap! This was the only way we could fit all 11 of us into a 5 bedroom house!
There was a swimming pool off the living room. (which is kind of scary!)

There was an alarm on the door, that we couldn't quite figure out how to turn off at first. That was fun, NOT! I looked through the very vague welcome book that was left for us, but saw absolutely no directions for turning off the alarm. Through trial and error, we figured out that you had to push it just before going out, and shut the door quickly and then when you came in, push it right away. Otherwise, you were rewarded with ear splitting beeping! It was a nice safety feature, but directions would have been nice! There was also a fence between the house door and the pool. Even so, I sat the kids down and threatened them to NOT even LOOK at that door without a grown up right next to them. I made sure Corey knew that he was NOT considered a grown up in my book. They know how serious I am about pool safety, so they listened very well.
Apparently, while the kids and I were swimming, an air conditioning repairman came to our door to fix the a/c. Which was good, because the house was getting hot and stuffy. When Brian told me the repairman was there, I got confused, because I had not called anyone, and the owner was in England. Apparently the management team had been out and realized the A/C wasn't working.
After a brief swim, I ask Brian if he just wants to stay at the house and go to
Walmart to get something to cook up for supper. He says he really wants to go to the Bass Pro Shop, so we load into the car and head off to International Drive..... on a Saturday..... yeah, good plan.
While we were leaving, the A/C guy told us that he would have the A/C fixed before we got home and the house would be cool when we got home. Strangely, as we were turning onto 192 from 27, the A/C guy passed us. This was only a few minutes down the road from the house we were staying at!
I-drive wasn't too bad, and we made it to the Bass Pro Shop fairly quickly. However, instead of taking me to the mall, Brian starts to park at Bass Pro Shop. I tell him that it's ok, I'll just drive over to the mall. At this point, he gets very upset with me, and asks what I'm talking about. I remind him of our earlier conversation about me going to the outlet mall. He seriously has no clue what I'm talking about, or at least pretends not to. So, he storms off, into the store. I wait briefly to see if he is coming back, then slide into the driver's seat and go across the street to the outlet mall, which really is just the Disney outlet store to me, because I don't care about any of those other stores in there!
I was pretty excited, because I knew that they had "remodeled" the mall since we were there last year. Well, remodel is not the right word! They must have bull dozed the entire thing down, because what was once an enclosed mall was now a nice bright airy open mall.
Arminda took some pictures:
The kids and I quickly located the
Disney store and started in for some serious shopping or at least some serious looking!
I was still pretty upset about the whole argument with Brian, but I knew we would both get over it quick enough.
I didn't find many good deals this day, but Corey did pick out a pair of red Mickey
Crocs! Which, I could tell he really wanted, but was a bit hesitant to buy! So, me and a CM talked him into them, and he was very happy! While shopping, a CM took a picture of us trying on some cowboy hats, she was very friendly:
Yeah the dork gene runs strong in our family!
Arminda and Lydia got very excited when they found these:
My Mom had given everyone Disney gift certificates or Disney dollars for her anniversary (Yepers, my parents give
US presents on
their anniversary!) so, the girls bought themselves a lollipop.
I was anxious to get back across the street to get Brian and to get home to greet my parents, so I told the kids we had to get going. After I paid for the shoes, Arminda told me that while I was paying, a CM had asked her if she wanted to play a game. Arminda was a good girl and told her no, that we had to leave. When I found out, I told Arminda we had a few minutes, and she could play the game. The CM got out a book and asked Arminda some questions about different characters. She then dumped out a container filled with pins and told Arminda to pick one. She then gave Lyddy a little quiz and let her pick out a pin too. Corey was a little disappointed that he didn't get to play too. The girls both picked out rather boring pins, if you ask me or Corey, but they were happy with them. But, there were some REALLY cool ones that they didn't even look at!
After driving back to Bass Pro Shop, we quickly located Brian in the fishing section (of course!)He told us that after he had went into the store, he felt bad and had come back out to the parking lot so he could come with us, but we were gone already. So, he walked across the street to the mall looking for us. I felt really bad then, I should have waited a little longer. (but really, it WAS his fault.)
He was ready to go, (YEAH!!!) so we headed out. We still hadn't eaten, so we stopped at the Sonic Drive in. I had never eaten at one before, and I thought it was pretty fun!
We then drove to the house, where we saw that my parents and my brother David's family were already there, which was good, since it was 11:00 PM! When I walked in the door, my Mom told me that she didn't think the air was working, which peeved me greatly! Not that she had told me, but that the guy had NOT fixed the A/C! I found the "emergency contact number" and tried to call from the house phone. Unfortunately, the EMERGENCY contact number was long distance from the house, and I needed a calling card to call it!! (Give me a break!) Not having a calling card, I used my Dad's Tracfone. No one answered, so I had to leave a message.
And, since there is a deplorable lack of pictures in this installment, here is a picture of me calling the emergency contact:
Here's Brian after we got back to the house:
The only room that was unbearably hot was the girl's room, every other room had a fan it but theirs. Plus, there were four giggly excited girls sharing ONE room! They were SOOO excited and SOOO worked up that they did not fall asleep until around 1 AM. Barbara is deaf, so she did not hear them, and David is, well a man, so HE did not hear them!
I was nice, and explained to them that if I did not get any sleep, I would NOT be in a good mood in the morning.
It got quiet for about 30 seconds, then the giggling started again.
I went back in, and explained to them that Grandma was NOT a young little girl, and that she was right on the other side of the wall, and she REALLY needed her sleep if she was going to Disney in the morning. And REALLY did they want to be THAT mean to their GRANDMA???? (I know, I was laying the whole guilt thing on a bit thick)
Quiet for about 4 minutes, then MORE giggling.
I was beginning to think that Brian picked the room he had just so I would get MORE exercise! He of course was sound asleep...
I went in and I MIGHT have threatened bodily harm......
don't judge me......
Quiet for all of 4 minutes.....
Then, I hear the distinctive giggle of a red headed 5 year old.
Enough WAS ENOUGH!!! I had NOT slept in a WEEK! I was EXHAUSTED, AND we were getting up at 6:30!
So, I told Lydia, "Come on, you are sleeping in my room."
I put her on my bed, and she was out within a minute, as were the other girls.
I decided to reset the alarm on the alarm clock to 7:00, I needed SOME sleep after all!
I laid my head down on my pillow, and closed my eyes to slowly drift off into..
GGGAAAAAAAAAAAAAAAAGGGGGGGG
GGGGGGGAAAAAAAUUUUUUUGGGGG
GGGHHHHGUUUUUUAAAAHHHHGGGG!!
UGGH!!!! Brian was SNORING loud enough to wake the dead! I had packed his snore reducing pillow (which really really works for him) BUT, I realized at that point that I had left it at the hotel room in Detroit!!!

I pushed Brian, and told him to roll over onto his side. Sometimes this works long enough for me to fall asleep... but not tonight.
I probably got 3 hours sleep total, and then,
BEEP BEEP BEEP BEEP BEEP
Stupid alarm clock.....
But, it was time to get up, we were
GOING TO DISNEY!!!!
but first, I needed a pot of coffee
Up Next: Does the Emergency Contact REALLY get annoyed when you call him at 11:30 PM?
Will Teresa sleep walk though Disney????
Will we EVER find Heather......?????